Q: Which of the following statements about nutrient challenges faced by organisms is FALSE? Carnivores ...
A: There are various nutrient challenges faced by organisms in their environment.
Q: You are a population ecologist studying animals in a national park, and park managers are asking for...
A: Earth houses a large number of species in its biosphere.
Q: Explain the following statement: The O2 generated by photosynthesis is simply a by-product of the pa...
A: Photosynthesis is the process by which plants prepare their own food with the help of sunlight, wate...
Q: Certain proton pump inhibitors that inhibit secretion of stomach acid are among the most widely sold...
A: H2 blockers or histamine H2-receptor antagonists are drugs that minimize the acid production in the ...
Q: the following processes except a. alternative splicing to produce a secreted form of the T-...
A: Answer 1st answer - d) somatic recombination 2nd answer - d) CTLA4, SUPPRESSION
Q: 1. Let's imagine what would happen to the amount of DNA material in a cell if, when it reproduced, i...
A: * During mitosis there are the following phases G1 phase S phase G2 phase M phase * During G1 pha...
Q: 18. The figures below illustrate the similarities between ATP synthesis in mitochondria and chloropl...
A: ATP (adenosine triphosphate) comes under the category of energy molecule present in the human body t...
Q: A “calico” cat (left) is mainly white with patches of black and orange fur. a. Almost all calico cat...
A: Introduction: Chromosomes are the condensed form of chromatin present in the nucleus of the cells. T...
Q: Carbon, hydrogen, and oxygen from sugar molecules may combine with other elements to form other biom...
A: Introduction: The given diagram depicts the production of peptide bonds, which are responsible for t...
Q: 21. Oxygen consumption can be used as a measure of metabolic rate because oxygen is (A) necessary fo...
A: Introduction:An organelle is a biological structure within a cell that serves a specific purpose. Or...
Q: 1. What is the importance of Gregor Mendel's Law of Inheritance in Molecular Biology?
A: MENDEL'S LAW OF INHERITANCE IN MOLECULAR BIOLOGY INHERITANCE : It is defined as the process of trans...
Q: Why is the mechanism of ATP synthesis shared among both prokaryotic organisms and eukaryotic organel...
A: Adenosine triphosphate (ATP) is the energy-carrying molecule found in the cells of all living things...
Q: (a) Gryllus pennsylvanicus prefers sandy soil. (b) Gryllus firmus prefers loamy soil. Based on the i...
A: Geographic, behavioural, physiologic, or genomic obstacles or differences that prevent a species fro...
Q: What is sumoylation and how does it affects newly synthesized proteins?
A: SUMOylation :- It is a post translational modification that is involved in various cellular process....
Q: MATCH EACH WITH THE LETTER. 1. RIBOSOME 2. NUCLEUS 3. ROUGH ENDOPLASMIC RECTICULUM (ER) 4. SMOOT...
A: Matching of cell organelles with their functions :-
Q: What are the differences of sea lettuce from other kingdom
A: Sea lettuce belongs to Kingdom Plantae. Differences of Kingdom Plantae from other kingdoms are detai...
Q: In plants, the transition from water to land most likely happened once twice: ones in the moss linea...
A: The difficulties that the primary land plants needed to defeat going limp in land from gravity, the ...
Q: How does pH influence the growth of microbes? Why do microbes grow best at a particular pH and not a...
A: pH influences the occurrence and distribution of microorganisms, Microorganisms grow best at their o...
Q: The reactants and products of the light reactions. Explain how light supports the light reactions wi...
A: According to our guideline we can answer only the first three subparts of a question. So, please upl...
Q: A phylogenetic tree is a branching diagram that shows the evolutionary relationship among different ...
A: Evolution Evolution is the natural process where organisms keep changing according to the environme...
Q: What is the benefit of alternative splicing? Tho nolarit of a protein can be adiusted for other circ...
A: Alternative splicing is the process of removal of introns and joining of exons in different combinat...
Q: There are six basic categories of enzymes. Which enzymes remove electrons from, or add electrons to,...
A: According to Enzyme commission (EC), enzymes has been classified into 6 basic categories. These enzy...
Q: Coral reefs are being threatened and/or damaged by all of the following, except discharge of industr...
A: A coral reef is an underwater surrounding characterized by using reef-constructing corals. Coral ree...
Q: What is the value of mitochondrial fission and fusion?
A: Mitochondria is a double membrane-bound organelle.
Q: Bacterial cells contain which of the following structures? Choose all that apply. Group of answer c...
A: Eukaryotes have membrane bound cellular organelles like chloroplast, mitochondria, and most importa...
Q: TOPIC: The response of an HIV strain to antiviral drugs. Research your specific example of natural s...
A: As per our company guideline we are supposed to answer only first question or first 3 sub parts of t...
Q: Control over eukaryotic gene expression drives______ . a. transcription factors c. embryonic develop...
A: In eukaryotes, gene expression is influenced by a wide range of mechanisms such as loss of genes, am...
Q: Does the DNA content of the cell change from the beginning of interphase to the end of interphase? D...
A: Mitosis Mitosis is a process of cell division, where a single cell divides into two identical daught...
Q: Inversion heterozygosity occurs in organisms with one inverted chromosome and one noninverted homolo...
A: Paracentric inversion does not include centromere.
Q: DA mussel population's response to the introduction of fhe Asian shore crab. DA peppered moth popula...
A: species of Asian shore crab has a very broad diet, it has the potential to affect populations of nat...
Q: The complement pathway is a series of steps and the final steps lead to an effector function initiat...
A: The complement system helps or “complements” the ability of antibodies and phagocytic cells to clear...
Q: Meiosis_______ . a. occurs only in animals b. supports growth and tissue repair in multicelled spec...
A: Meiosis is a cell division that forms four progeny cells from a single parent cell.
Q: Homeotic gene expression _______. a. occurs via bacterial operons b. maps out the overall body plan ...
A: These are the genes which helps in the development of anatomical structures. Types of Gene Regulatio...
Q: What is the nature of the targeting sequence, and what distinguishes it from other types of targetin...
A: Introduction In the cell, there is a highly regularized transport mechanism that works for the tran...
Q: Enhancer 4 What should be the normality of 1 L saline water needed to be injected intravenously to a...
A: Osmotic pressure of blood =7.75atm Body temperature =37deggre C Saline water =1L
Q: Hello, can you pls explain the 5 different swimming styles and strokes. Thank you. • freestyle ...
A: Answer 5 different swimming styles and strokes 1.free style 2. Back stroke 3. Breast stroke 4. Butt...
Q: Explain the cell division limit and its fail-safe function
A: Introduction Almost all cells in the body can divide and form new daughter cells however, there are...
Q: elping tags: Biology, development, developmental biology, plants, cell elongation How is it that th...
A: Plant cell wall is dead for the fact that it is not composed of any living cell. This raised a quest...
Q: Because of risk of solanine poisoning, you should not eat the leaves, stems, or any part but the kno...
A: Solanine can be referred to as a colorless, alkaloid compound. It comes under the category of glycoa...
Q: 1. Describe what malaria is and where it is prevalent in what areas of the globe and in what habitat...
A: Often diseases are caused by various pathogenic microbes that are found in unhealthy and unhygienic ...
Q: If the pressure in the ventricles is higher than the pressure in the atria, but lower than the press...
A: Heart valves open and close in response to pressure changes inside the heart chambers. the fluid und...
Q: How do selective-serotonin reuptake inhibitors (SSRIS) increase serotonin in the synapse? O They cau...
A: Note: As Per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: Ser...
Q: Sdve this response. Question 1 Which of the following can cause evolution? Select all that apply. OA...
A: Evolution is change in characteristics of a species over successive generations. The idea of evoluti...
Q: Remember that although there are many interesting ideas about genetic engineering of plants and anim...
A: Transgenic bacteria are bacteria whose genome contains genes from other organisms that have been del...
Q: on dioxide in C3 plants in preparation for the Calvin cycle. Explain the chemical pathway used to fi...
A: The process by which plants use sunlight, water, and carbon dioxide to create oxygen and energy in t...
Q: rections: Answers must be in essay form. Outline form is not acceptable. Labeled diagrams may be use...
A: Introduction: NADH is essentially produced only during the cellular respiration and it gets oxidised...
Q: veterinary science
A: Answer :: In veterinary science, the three examples of mother nature's ID methods. Personification o...
Q: Research your specific example of natural selection to better understand how and why the population ...
A: Natural selection: Ability to adapt according to the natural environment to survive and reproduce be...
Q: Differentiate vasculogenesis from angiogenesis. Explain why blood vessels degenerate as well as the ...
A: Vasculogenesis is the process of blood vessel formation from endothelial progenitor cells. Angiogene...
Q: Our DNA sequence: 5' - CGCTTATAATCGTTACGACGGCAATTA CGGGATTCCTCGCGAAA - 3'. What is the RNA transcrip...
A: The nucleic acids are DNA and RNA. Nucleotides, which have a five-carbon sugar backbone, a phosphate...
- Differentiate sterilization from disinfection.
- Differentiate sterilization from disinfection.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Other than the application of heat, name other methods of sterilization. Define the methods and give examples of materials sterilized in each method.In sterilization, which among the supplies, instruments, glassware, etc. under the list of materials can be sterilized using either or both equipment below? List them down under the category: a) For “autoclaving” only, B) For Dry heat oven sterilization ,And C) Can be sterilized with either. Materials: 200-ml Erlenmeyer flask Stove 500-ml Erlenmeyer flask Autoclave 10-mL graduated cylinder Analytical balance 100-ml graduated cylinder pH meter Spatula Stirring rod 100-mL beaker Test tubes Distilled water Petri dish Stirring rod Alcohol lamp Glass dropperWhy must you first clean debris from items before beginning disinfection or sterilization? (
- Distinguish between the term’s sterilization, disinfection, antiseptics, and decontamination. Describe the circumstances in which these terms may be used.Define disinfection. Compare/contrast it with sterilization, antisepsis and bacteriostasis. Give the modes of action of the different antiseptics/disinfectants used in the activity (5% sodium hypochlorite (bleach), 0.05% sodium hypochlorite (bleach), 70% alcohol, 40% alcohol, Iodophor (Betadine), and Mouthwash)Distinguish between a sterilant, a disinfectant, and anantiseptic. What is cold sterilization?