Consider the fructose-1,6-bisphosphatase reaction. Calculate the free energy change if the ratio of the concentrations of the products to the concentrations of the reactants is 21.7 and the temperature is 37.0°C? AG' for the reaction is -16.7 kJ/mol. AG = kJ/mol
Q: Tt O 8. What are the driving forces that promotes tertiary -3D and quaternary -4D structure…
A: Proteins are the biological macromolecules. They show great diversity in their structure and…
Q: The sugar molecules shown below are a) Enantiomers b) Epimers c) Anomers d) Diastereomers
A: Stereoisomers are defined as molecules that have the same molecular formula and sequence of bonded…
Q: Exhibit 6A This is a reaction going on in your muscle cells right this very minute: dihydroxyacetone…
A: ● Enzyme Inhibition is of two types: A) Reversible and B) Irreversible.● Reversible enzyme…
Q: Parts of the mechanism for lysozyme are shown below. The catalytic lysozyme residue side chains can…
A: Lysozymes cleave the glycosidic bond between N-acetylmuramic acid (Mur2Ac) and N-acetylglucosamine…
Q: An incomplete structure of a porphyrin ring is shown below. The structure is missing three pi bonds…
A: Porphyrin molecules are a popular biological moiety with applications in pharmaceutical chemistry,…
Q: Genetics Question 24
A: The question is asking for the number of sister chromatids in a unicorn cell at metaphase of…
Q: The activity of ________ will result in an increasedpositive charge on the histone.…
A: Answer: b. Histone deacetylaseExplanation:• Histone acetyltransferases (HATs): These enzymes add an…
Q: What is the IUPAC name of the following compound? (No need to provide E/Z designation.) CO₂H
A: IUPAC name is 3,3,6-Trimethylhept-6-enoic acidExplanation:Step 1:Rules for IUPAC Naming Find the…
Q: Cellulose contains___ linkages that ___ be digested by animals. a β1--> 4 glycosidic ; canNOT b…
A: Cellulose is a polymer of units. It is used by plants and some microbes as a means of mechanical…
Q: Provide a schematic representation of the reactions in the beta
A: Beta oxidation is a fundamental metabolic process involving catabolism of fatty acids into energy as…
Q: 5'-AATGCCTCAGCCGATCTGCCTCGAGTCAATCGA TGCTGGTAACTTGGGGTATAAAGCTTACCCATGGTATCGTAG…
A: PCR is a lab technique used for amplification of target DNA sequence by using a thermostable DNA…
Q: v (mm/sec) 5.0 4.0 3.0 2.0 1.0 0.0 0.0 Estimate from the M-M plot below: Vmax, Km, Keat, and enzyme…
A: The rate (v) v/s substrate concentration ([S]) graph of enzymes that follow MM (Michaelis-Menten)…
Q: Ringlemann scale is used to analyze O a. Carbon monoxide Ob. Nitrogen dioxide O c. hydrocarbons O d.…
A: The objective of the question is to identify the substance that the Ringlemann scale is used to…
Q: Compare the experimentally defined locations of the amino acids from the SCAM data with the…
A: The location of the amino acids in AlaE according to SCAM is given below.Amino…
Q: Genetics 8 Q1
A: The question is asking to identify the type of chromosome rearrangement that involves two…
Q: s) In two experiments carried out in a research lab, an enzyme reaction is run with and without an…
A: Enzymes are proteins that catalyze biochemical reactions. They contain an active site where the…
Q: Histone modifications are inherited across ________ but not ________. Question 6 options:…
A: Histone modifications are inherited across mitosis but not meiosis. Histone modifications are…
Q: Which four statements about amino acids are true? The form of glycine used by the human body is…
A: Amino acids are organic compounds that serve as the building blocks of proteins. They have a…
Q: Which model (2D topology or trRosetta) is likely a better representation of the actual protein AlaE,…
A: In the context of protein structure prediction, the posterior probability is generally considered a…
Q: What category of biomolecule would the following structure be associated with: 0= HO HO OH OH 애애 OH…
A: The structure of the molecule is given - It is a polyhydroxy keto compound having condensed…
Q: Carbamazepine is a lipid -soluble antiepileptic drug that has a larger volume of distribution in…
A: The objective of the question is to understand the effect of obesity on the elimination half-life of…
Q: Write out each of the eight chemical reactions of the citric acid cycle. Draw the structures of the…
A: Citric acid cycle is also called as tricarboxylic acid cycle or Krebs cycle. This is the second…
Q: ucleotide c a. Draw a likely mechanism for the following reaction (EC 6.3.4.2) from ribonucleotide…
A: Both reactions (a) catalyzed by [EC 6.3.4.2] and (b) catalyzed by [EC 6.3.3.1] involve transfer of…
Q: つく 146 Bb 9146 Bb 10311 Class E Etsy Traps E Traps New Free Chat + ☆ 口出…
A: Turnover number refers to the number of substrate molecules that is converted to the product…
Q: Question 1: tRNA and amino acyl tRNA synthetases Part a: How many codons encode the amino acid…
A: Methionine is encoded by a single codon, AUG, which also serves as the start codon in protein…
Q: The anticodon _______ can form a Wobble interaction with 5’ UAG 3’? Please note the directionality…
A: Codon is defined as the combination of three ribonucleotides of mRNA. These are complementary to…
Q: Derive an Equation that explains the realtionship between kE and kN with respect to the equilibrium…
A: Equation: This reaction is governed by the equilibrium constant , where: - (1)Assuming that…
Q: Question 7
A: The objective of this question is to determine how many of the bacterial cells will be radioactive…
Q: The hydrolysis of sucrose has the following data. Time (min) 0 30 60 90 130 180 [Sucrose] (M) 0.5011…
A: To determine the half-life of the reaction, first identify the order of the reaction. The order of…
Q: 8. Amino acids typically consist of a central carbon atom. Attached to this central carbon are an…
A: If the a-hydrogens in the a-alpha helix are replaced by a second side chain (a second R group), it…
Q: Suppose you prepared one additional tube of albumin unknown and got an absorbance value of 1.99.…
A: For protein estimation,A standard curve must be constructed before the concentration of an unknown…
Q: Which of the following is(are) formed upon addition of 1 mol of Br2 to 1,3-cyclohexane? Br Br 1, 2…
A: for given chemical reaction,Option 4 is correct.(only 2 and 4)Explanation:Step 1The role of reagents…
Q: QUESTION 2 10 11 12 Glucose Pyruvic acid 2 ATP Lactic acid 13 36 ADP 36P 36 ATP Match the FOLLOWING:…
A: Answered the question.
Q: O Ala O Asp O Asn H₂C. O Arg O The central bond in this Newman projection (the one whose torsional…
A: There are 3 torsional angles in a peptide. Each torsional angle is due to rotation about one…
Q: For the following reaction: HNO3 H2SO4 NO2 NO2 NO2 10% 8% 82% 1. Write a reasonable mechanism, using…
A: 1) isopropyl benzene is considered to be electron donating by positive inductive effect of its…
Q: STEM Workplace Practices Q4
A: The objective of this question is to understand the difference between a product contaminant and a…
Q: _________ could lead to an epigenetic disorder caused by loss of function of a gene. Question 12…
A: Epigenetics is the study of how the behavior and environment can cause changes that affect the way…
Q: serine proteases act via a two-step catalytic mechanism. However, as a critical scientist, you may…
A: Serine proteases are protein cleaving enzymes that have Serine, Histidine and Aspartate (the…
Q: Vmax Km x10 TOOLS
A: Vmax and Km are the two important parameters in enzyme kinetics.Vmax is the maximum rate of an…
Q: All blood groups are True False composed of glucose, fucose and N-acetylglucosamine
A: ABO blood typing is a lab test performed to categorise human blood into four groups based on the…
Q: What further experiments are needed to provide confidence that the structural data obtained from the…
A: SCAM analysis predicts whether an amino acid in a transmembrane protein is within the membrane,…
Q: What is the molecular weight of the molecule that gets eluted from the column at 10 ml?
A: The given graph shows a linear relationship between the elution volume (ml) on x axis and IgM…
Q: Q1) a) Draw the absorbance spectra for the following DNA samples. a. Pure DNA without protein…
A: “Since you have posted multiple questions with multiple sub parts, we will provide the solution only…
Q: Draw the structure of cholesterol and write the biosynthetic relations of steroid hormones starting…
A: Cholesterol, a 27-carbon molecule, is the most common steroid in the body and plays a crucial role…
Q: Glycogen contains___ linkages that ___ be digested by animals. a α1 --> 4 glycosidic ; can b α1-->…
A: Glycogen is the storage sugar in animals. It is composed of units. There are two types of…
Q: 1. Suppose the following kinetic data was collected for an enzymatic reaction For each substrate…
A: Enzyme are proteins that catalyse the conversion of substrate into product. The mathematical…
Q: D. Explain why a protein (polypeptide chain) will assume a different 3-dimensional structure in: (1)…
A: The three-dimensional structure of a protein, also known as its native conformation, is critical for…
Q: 3. (a) ( The equilibria for release of molecular dioxygen (O2) and protons (H+) by human hemo-…
A: See below sectionExplanation:Detailed explanation:a): The image you provided illustrates a chemical…
Q: II. ATP ACCOUNTING, Provide what is being asked for. Show all relevant calculations and summarize…
A: The production of ATP in liver cells when the malate-aspartate shuttle isn't working properly. The…
Q: Make a figure that includes the hydropathy profile analysis, the TMHMM analysis and the TOPCONS…
A: The 3-D structure (topology) of transmembrane proteins can be studied with relative accuracy using…
Unlock instant AI solutions
Tap the button
to generate a solution
Click the button to generate
a solution
- G6P(ag) F6P(aq) AG°=+1.7kJ/mol at 25 °C Consider the reaction: Estimate the fraction of F6P (Fructose 6 Phosphate) in equilibrium with G6P (Glucose 6 Phosphate) at 25 °C, where the fraction is defined as [F6P]/([F6P]+[G6P]). Show ALL your work.The standard free energy change for the reaction catalyzed by phosphoglucomutase is -7.1 kJ/mol. Calculate the equilibrium constant for the reaction. Calculate AG at 37°C when the concentration of glucose-1-phosphate is 1-mM and the concentration of glucose-6-phosphate is 25-mM. Is the reaction spontaneous under these conditions? HOCH, -20;POCH, H H H H H H ОН Н НО ОН Н H НО ОН H ОН H. ОН Glucose-l-phosphate Glucose-6-phosphateConsider the following phosphoryl group transfer reaction which is the first step in glucose catabolism by glycolysis: Glucose + ATP + Glucose 6-phosphate + ADP The AG for the reaction is -16.7 kJ/mol. (R= 8.314 J/(K. mol) (a) Calculate Keq for the reaction at 25°C (b) What is the ratio of [Glucose 6-phosphate] to [Glucose] if the ratio of [ADP] to [ATP] is 10?
- Glucose 1-phosphate is converted into fructose 6-phosphate in two successive reactions. Reaction 1: Glucose 1-phosphate → glucose 6-phosphate AG'° = -7.3 kJ/mol Reaction 2: Glucose 6-phosphate → fructose 6-phosphate AGʻ° = +1.7 kJ/mol Using the values given, calculate the standard free-energy change, AGʻ°, ,for the sum of the two reactions: sum > Sum: Glucose 1-phosphate → fructose 6-phosphate AG'°, kJ/mol sum Calculate the equilibrium constant, K', eq > for the sum of the two reactions. K'e eq IIThe standard free energy change for this reaction in the direction written is +23.8 kuimol. The tabie shows the concentrations of the three intermediates in the hepatocyte of a mammal. Intermediate Concentration (M) Fructose 1.0-bisphosphate 0.000028 Gyoeraldehyde 3phosphate 0.0000068 Ditydroxyacetone phosphate 0.000032 At body temperature (37 "C). what is the actual free energy change for the reaction (in kimol) ?Inside cells, the AG value for the hydrolysis of ATP to ADP + Pi is approximately -50 kJ/mol (-12 kcal/mol). Calculate the approximate ratio of [ATP] to [ADP][Pi ] in cells at 37°C. AG = AG + RT InKe R= 8.315 x 10³ kJ mol deg T= 298 K Table 15.1 Standard free energies of hydrolysis of some phosphorylated compounds Compound kJ mol- kcal mol- Phosphoenolpyruvate 1,3-Bisphosphoglycerate Creatine phosphate ATP (to ADP) -61.9 -14.8 -49.4 -11.8 -43.1 -10.3 -30.5 - 7.3 - 5.0 Glucose 1-phosphate Pyrophosphate Glucose 6-phosphate -20.9 -19.3 -4.6 -13.8 3.3 Glycerol 3-phosphate - 9.2 2.2 biochemistry
- What terms would best describe the above coupled reaction? (If the DGo for ATP hydrolysis into ADP + inorganic phosphate is -7.3 kcal/mole, and the DGo for maltose synthesis from glucose + glucose is +3.7 kcal/mole, calculate the standard free energy change for the combined reaction of ATP + glucose + glucose g ADP + maltose + inorganic phosphate.) it is non-spontaneous and endothermic (because the overall DGo is negative) it is spontaneous and exothermic (because the overall DGo is negative) it is non-spontaneous and endothermic (because the overall DGo is positive) it is spontaneous and exothermic (because the overall DGo is positive) it is non-spontaneous and exothermic (because the overall DGo is negative)Assume that in a certain cell, the ratio of products/reactants or Keg = 809.5 (Keq is dimensionless) for the reaction Glucose + 2ATP > Glucose-1,6-diP + 2ADP, at a particular instant, the concentrations of each compound were Glucose =2.4M, ATP =11.1M, ADP -12.8M and G-6-P -28.4M. Calculate the difference (dimensionless) between Keq and the ratio of products/ractants at this instance, in this cell, to five decimal placesConsider the following reaction: Glucose 6-phosphate + Glucose 1-phosphate After reactant and product were mixed and allowed to reach equilibrium at 25C, the concentration of each compound was measured: (Glucose 1-phosphate] - 0.002 M [Glucose 6-phosphate 0.05 mM Calculate the Keg and the AG knot prime (e.g. standard free energy change). O Keg- 40: AG knot prime 9.14 kJ/mol O Ken- 19: AG knot prime -7.3 kJ/mol O Keg" 0.04: AG knot prime-7.98 kJ/mol Kea 4: AG knot prime -914 kJ/mol O Keg 40: AG knot prime - 9.14 k/mol
- The turnover number of the enzyme fumarase that catalyzes the reaction, Fumarate + H20 ===→ L-malate, is 2.5 x 103 S - l and Km = 4.0 X 10- 6 mol/L. Calculate the rate of conversion of fumarate to L-malate if the fumarase concentration is 1.0 x 1 0 - 6 mol/L and the fumarate concentration is 2.04 x 10- 4 mol/L.The enzyme aldolase catalyzes the reaction shown in the glycolytic pathway: Fructose 1,6-bisphosphate dihydroxyacetone phosphate + glyceraldehyde 3-phosphate The AG" for the reaction is +23.8 kJ mol¯¹ (+5.7 kcal mol−¹), whereas the AG in the cell is −1.3 kJ mol¯¹ (−0.3 kcal mol¯¹). Calculate the ratio of products to reactants under standard (equilibrium) conditions at 37°C. [products] [reactants] 7 x10-5 [products] [reactants] Incorrect Aldolase ===== Calculate the ratio of products to reactants under intracellular conditions at 37°C. 4 ×10-5 Incorrect Complete the statement using your results. under standard conditions under intracellular conditions A reaction that is endergonic under standard conditions can be converted into an exergonic reaction by maintaining the ratio of products to reactants below the equilibrium value.The hydrolysis of ATP has an enthalpy and entropy of -24.3 kJ/mol and +21.6 J.K-1.mol-1, respectively, at 37 o C. What is the free energy change for the hydrolysis of 5 mols of ATP? Explain what contributes to the negative enthalpy change and positive entropy change in this reaction. What physical characteristics of the reaction would change if an ATP hydrolase enzyme is added to the solution?