7:12 What is not true for Sequence tagged site (STS) markers: O cannot be mapped by fluorescence in situ hybridization (FISH) O subset of STS markers are known as expressed sequence tag (EST) markers O can readily be screened by a PCR assay O short DNA sequences that occur at a unique location in the genome

7:12 What is not true for Sequence tagged site (STS) markers: O cannot be mapped by fluorescence in situ hybridization (FISH) O subset of STS markers are known as expressed sequence tag (EST) markers O can readily be screened by a PCR assay O short DNA sequences that occur at a unique location in the genome

Name: 7:12What is not true for Sequence tagged site (STS) markers:O cannot
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 7:12What is not true for Sequence tagged site (STS) markers:O cannot be mapped by fluorescence in situ hybridization (FISH)O subset of STS markers are known as expressed sequence tag (EST) markersO can readily be screened by a PCR assayO short DNA s

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter18: Dna Technologies: Making And Using Genetically Altered Organisms, And Other Applications

Section: Chapter Questions

Problem 9TYK

See similar textbooks

Similar questions

3. Animation 12.1: This table shows results from allele-specific oligonucleotide hybridization analyses conducted on three different patients. The analyses all used the same probes constructed to test for the presence of a mutant gene. A plus sign (+) indicates hybridization occurred and a negative sign (-) indicates no hybridization occurred. Patient #1 Patient #2 Patient #3 Probe for normal allele Probe for mutant allele Which patient(s) is/are homozygous for the mutation and which patient(s) is/are heterozygous for the mutation? O Patients #2 and #3 are homozygous and Patient #1 is heterozygous for the mutation. O Patient #2 is homozygous and Patient #1 is heterozygous for the mutation. O Patient #1 is homozygous and Patients #2 and #3 are heterozygous for the mutation. O Patient # 1 is homozygous and Patient #2 is heterozygous for the mutation.
Are you a hidden heterozygote? A PCR analysis (part2) Agarose gel electrophoresis and interpretation la: Several factors (including agarose gel concentration, time and current) affect migration of DNA fragments through the agarose gel. Briefly explain how each of these factors affects DNA migration. Agarose gel concentration: Time: Voltage: 1b: Do DNA fragments move towards the positive or negative end of the gel box? Explain your answer. 1c: What is the purpose of the Tris-Acetate-EDTA (TAE) buffer that the agarose gel is prepared with and submerged in for running? What would happen if you used water to prepare and run the gel instead of TAE buffer? 1d: If the student is homozygous for the brown allele, how many bands will they see in the lanes for the blue and brown allele samples? (circle one) Brown sample: 0 Blue sample: 1 2 more than two. 1 2 more than two. le: If the student is homozygous for the blue allele, how many bands will they see in the lanes for the blue and brown allele…
6 of 11 The sequence shown below is the 5' to 3' strand of a dsDNA template. You are asked to design PCR primers to amplify the sequence that is in bold and underlined. (Select the binding sites of your chosen primers within the underlined region rather than in the flanking sequence.) 5-CAGTTAACTGGTTATAAGAAACCTGCTTCAAGAGAGCTTAAAGTTACATTTTTCCCTGACTTAAATGGTG АTGTGGTGGСТАТTGATTAТАААСАСТАСАСАСССТСТТTTAAGAAAGGAGCTAAATTGTTACATAAACС-3' What is the 5' to 3' sequence of the reverse primer? O 5-TTC GTC CAA AGA ATA TTC-3' O 5'-CAA TAT TCT TTG GẠC GAA-3' TER O 5-GTT AAA TCG AGG AAA GAA-3' O 5-GTT ATA AGA AAC CTG CTT-3 5'-CAA TTT AGC TCC TTT CTT-3' Assessment Navigator Submit Questionmark Ondemand licensed to University of Dundee 41 MAR étv 30 MacBook Air DII 20 000 F9 esc F7 F8 F5 F6 F1 F2 F3 F4 2$ & ! 7 8. < co 土
6 of 11 The sequence shown below is the 5' to 3' strand of a dsDNA template. You are asked to design PCR primers to amplify the sequence that is in bold and underlined. (Select the binding sites of your chosen primers within the underlined region rather than in the flanking sequence.) 5'-CAGTTAACTGGTTATAAGAAACCTGCTTCAAGAGAGCTTAAAGTTACATTTTTCCCTGACTTAAATGG TG ATGTGGTGGCTATTGATTATAAACACTACÃCACCCTCTTTTAAGAAAGGAGC TAAATTGTTACATAAACC-3' What is the 5' to 3' sequence of the reverse primer? O 5-TTC GTC CAA AGA ATA TTC-3' O 5-CAA TAT TCT TTG GAC GAA-3' 5'-GTT AAA TCG AGG AAA GAA-3' O 5-GTT ATA AGA AAC CTG CTT-3 O 5'-CAA TTT AGC TCC TTT CTT-3'
Select the definition of a microsatellite. short pieces of DNA surrounding the periphery of the nucleus short pieces of DNA that flank most genes segments of DNA cut by restriction enzymes small DNA sequences that are repeated consecutively a few times to many times O pieces of DNA that can move through the genome by transposition How are microsatellites used in genetic studies? to identify individuals within a population used as markers in the sequencing of the human genome to identify genetic variants in genome-wide associations studies to test if a population is in Hardy–Weinberg equilibrium to transfer genes between organisms O O
STR markers: are point mutations detectable by DNA sequencing are variations in the number of repeats of very short DNA motifs (2-10 nucleotides) □have high polymorphism are mutations leading to proteins or blood groups that can be differentiated by antigenic testing from a blood sample ☐have low polymorphism no correct answer are changes of a few nucleotides leading to the absence or presence of a site recognized by a restriction enzyme are variations in the number of repeats of medium-sized DNA motifs (10-100 nucleotides) can be located in coding sequences are located exclusively on autosomes
True or False: 1. The 6X HIS tag is required for a eukaryotic protein to be expressed in E. coli 2. BAC vectors are an appropriate choice for cloning cDNAs 3. Cluster analysis of micro-array data groups together mRNAs of similar sequence 4. In genomic DNA, on average EcoR1 restriction sites are more common than Mse1 restriction sites 5. Tags such as HA that are fused to proteins always compromise their function.
(i) For the chromatogram below, what is the sequence of the template DNA from base 115 to 125? CTGTGTGAAATTGT TA T CCGC T CA CA AT T C CACA CA A CATA CGAGC CGGAAG CA TA A 110 120 130 140 150 160 (ii) An allele of a gene has the following change in it's sequence ATG GTG CÁC CTG ACT CCT GTG GAG AAG TCT compared to the wild type ATG GTG CAC CTG ACT CT GAG GAG AAG TCT With reference to the sequence; there is a codon, resulting in a change from is a mutation in the to which mutation.
In the following gel showing stained bands of the Alu insertion sequence, what is the genotype of individual 2? 941 bp 641 bp->>> 1 2 3 4 5 6 Homozygous for the 641 bp sequence that does not contain in the Alu insertion Heterozygous, containing one 941 bp sequence and one 641 bp sequence O Homozygous for the 941 bp sequence containing the Alu insertion
27. Given the following plasmid map, list how many fragments would exist and their bp length when treated with Hindll and Nde1 Dail 91 Ben BI 51 EstAPI 179 BemBI 2683 Ndel 183 Kasl - Narl - Sfol 235 Bgll 245 Fspl 256 Pul 276 EcoO1091 2674 Aatll - Zral 2617 BiM 2542 Sspl 2501 Prull 306 Benrl 364 Acll 2297 BæAl 387 Apol - EeoRI 396 Xmnl 2294 lacza haall - Sacl - Ecos3KI 402 Accbs1 - Kpnl 400 Awal- BsoN - Smal- TapM I- Ymal 412 Beal 2215 MCS Scal 2177 haml 417 Xhal 0 Pvul 2066 Accl - Hinl - Sall 29 pl. Alau a sb 434 Avall 2059 PUC19 2,686 bp BerDI 1985 Sphi 441 Hindi 447 Acll 1924. Fspl 1919 Prull 628 Avall 1837 Til 641 EsaXI 659 me AllI 1822 Rgll 1813 Bpal 1784 BSPOI - Sapl 683 BsrFl 1779 Bsal 1766 Thl 781 AII - Peil 806 BerDI 1753 Dal 908 Bmrl 1744 ori Aldl 1694 BkiM 1015 BseYl 1110 AlwNI 1217 BeeN 1292 dy
A cloning vector map is shown below. EcoRI Bam Ban Hind P-galactosidase Amp Bam Bam EcoRI Ori C Which restriction site is best for inserting a DNA fragment for selection of chimeric plasmid containing colonies? 1) They're all equally good. 2) Hindll 3) EcoRI 4) BamHI
2 of 11 Identify the incorrect statements O Taq polymerase can incorporate nucleotides at a rate of -60bp per second at 70°C It is possible to re-amplify PCR products to obtain a higher yield of the target Steps in PCR are typically repeated (cycled) 25-35 times The maximum PCR product length that Taq polymerase can typically amplify is approximately 10 kbp V Extension is the second step in PCR