A transversion mutation would be replacing T by: a. C b. T c. either A or G d. U
Q: SMC proteins participate in DNA bending that contributes to folding and condensation. True False
A: SMC is expanded as Structural Maintenance of Chromosomes. SMC complexes are the ones that represent…
Q: Unsaturated fatty acids have ----. Question 16 options: multiple amide groups in their…
A: Fatty acids are the simplest form of lipids and serve as constituents in a large number of complex…
Q: . Considering the following nucleotide sequence in an mRNA molecule: 5’ AUG UUA CGU AAU GCU GUC…
A: Since you have posted a question with multiple subparts, we will solve the first three subparts for…
Q: TRNA and 5S RNA genes both have the following internal control region. BoxA BoxB BoxC
A: An internal control region is determines as a sequence that is made up of DNA and is located only…
Q: Which of the following molecules is NOT an amphipathic? phosphatidyl choline cholesterol…
A: Amphiphatic are the molecules which contain both hydrophobic as well as hydrophilic in their…
Q: 2. Dr. Kim at Research Center performed shotgun Sanger sequencing on an unknown DNA sample, and…
A: In conventional sequencing method, in a reaction mixture, single-stranded molecules of the DNA,…
Q: . Label each statement about the polynucleotide ATGGCG as true or false. a) The polynucleotide…
A: Polynucleotides are found naturally in all living organisms and play a variety of roles in them. A…
Q: Explain how ATP levels regulate glycolysis in resting muscle
A: Glycolysis is a catabolic pathway in which carbohydrates are oxidized to two molecules of pyruvate.…
Q: Carbohydrates and lipids are composed of the same chemical element, but in different proportions.…
A: Carbohydrates and lipids are the primary energy source for metabolic process in the body.
Q: The Lineweaver-Burke plots of a reaction without inhibitor and one with non-competitive inhibitor…
A: Enzymes are catalysts that enhance the rate of biochemical reactions.
Q: 2. Which of the following is false about allosteric feedback inhibition? a) Bacterial enzyme system…
A: Feedback inhibition is a biological regulatory mechanism in which the final product of an enzyme…
Q: Why in some instances are cytosines mutational hotspots?
A: Throughout a nucleotide sequence, mutation frequencies vary. Mutation "hotspots" are positions where…
Q: What is the difference between the two salt precipitation methods: salting in and salting out?…
A: The solubility of a protein in solution depends on the concentration of the salt present in…
Q: What happens to the functionality of a denatured enzyme? How can that resul be explained with the…
A: Enzymes are the biological catalysts that increase the rate of a biochemical reaction. They are…
Q: 3. Do enzymes act better under acidic or alkaline pHs?
A: Most favored pH value - the pH point where the enzyme has most activity - is known as the optimum…
Q: The DNA and associated proteins of a eukaryotic chromosome are called Chromatin Chromatosome…
A: Eukaryotic chromosomes are made up of DNA that is tightly coiled around histone protein clusters.…
Q: Group I and II introns are present in the following classes of RNAS. MRNAS O miRNAS SİRNAS TRNAS
A: Mobile introns are defined as the intervening sequences. These sequences are the ones that are…
Q: Explain in detail the role of biotechnology in production of baker’s yeast.
A: For millennia, humans have used the metabolic activity of yeasts in baking and brewing. The creation…
Q: Which snRNP leaves in order to form the active spliceosome? OU1 U3 OU4 U2
A: At least five different types of snRNPs join mainly the spliceosome to specifically participate in…
Q: 5. Salivary a-amylase cleaving a(1 example for which type of specificity? a) Group specificity b)…
A: Group specificity : Enzyme will catalyze the reaction on a function group of different molecules…
Q: How does compromised pyruvate kinase activity lead to anemia?
A: Pyruvate kinase is a catalytic enzyme that catalyzes the final step of glycolysis, which is crucial…
Q: Loss of function mutation results in a _ allele.
A: Mutations are sudden changes in the gene sequence. When these changes causes loss of function of an…
Q: Reset Help The protein appears to have regions that are closely associated with the region between…
A: TAL effectors are transcription factors secreted by bacterial pathogens. They are virulence factors…
Q: What information can be inferred from this graph? 250 200 Diabetic subject 150 100 Normal subject 50…
A: The liver and the pancreas act together to balance blood glucose level. When the pancreas can sense…
Q: A single gene mutation causing several, and seeming unrelated problems is called Entropy Pleiotropy…
A: The diseases that are caused due to single gene mutation are known as single gene disorders.
Q: When using blunt-end primers, how would you determine the correct plasmid construct from the…
A: Ligation is the joining or ligation of two nucleic acid fragments through the action of a ligase…
Q: What is the role of decarboxylation in fatty acid synthesis? Describe another process discussed in…
A: Fatty acids are the body's fat-building blocks. Acetyl-CoA is used to make fatty acids. Fatty acid…
Q: Compare the old (Boot's method) and new (Green) syntheses of Ibuprofen in the light of Green…
A: Introduction: Ibuprofen is a non-steroidal anti-inflammatory drug that is widely used in the…
Q: topic: sds-page gel If APS is not available, what other chemicals can be used alternatively to…
A: APS stands for Ammonium Persulfate. It is an oxidizing agent that is used along with TEMED in order…
Q: TRUE OR FALSE: Please answer each item. Hormones, such as testosterone, estradiol and progesterone…
A: The most abundant lipid in the membrane is a phospholipid. Ruff degradation is a functionally…
Q: J A positive result for Fohl's test is the formation of a black precipitate in the form of lead. O A…
A: Fohl's Tests - This test is performed to detect the presence of amino acid which containing sulfur.…
Q: Describe the β-oxidation of the fatty acid palmitate
A: Beta oxidation in biochemistry and metabolism is a catabolic process through which fatty acids…
Q: Which enzyme removes a phosphate from the 5' end of the MRNA, leaving two phosphates?
A: mRNA is a messenger RNA, it is a single stranded RNA which carries the genetic sequence of the DNA…
Q: a) Lock and key model versus induced fit model of enzyme activity. (b) Competitive and…
A: Introduction: All the biochemical reactions are enzymes catalyzed in a living organism. Enzymes are…
Q: Which of the following bind to the motif GGAGG in human COLQ gene? SRSF1 hnRNPH Both None
A: RNA is a vital component of the cell that is required for a variety of biological functions,…
Q: A student performed Benedict's reagent test on an monosaccharide. As she added Benedict's reagent to…
A: Benedict's reagent test is a test in which reducing monosaccharides sugars can be identified. Such…
Q: LLNSAMSRLYSLRSS 1.Assuming this sequnce is enitrely alpha helical what is the hydrogen bond…
A: The αα-helix is an ordered secondary conformation of proteins. An αα-helix is stabilized by the…
Q: 4. Draw the condensed structural formula for the triacylglycerol made from 3 saturated fatty acids…
A: Triglycerides are the main constituents of body fat in humans and other vertebrates and are also…
Q: Create a diagram showing the biosynthesis of prostaglandin and leukotrienes in the body.
A: Prostaglandins : These are lipid compounds called as eicosanoids, found in tissues in humans and…
Q: `NH HO `NH2 ОН ОН
A: Nucleoside contains a nitrogenous base and a ribose or deoxyribose sugar molecule.
Q: H1. Estimate the TKN associated with a sample having 50 mg/L of cell tissue and 10 mg/L of ammonia.…
A: TKN (Total Kjeldahl Nitrogen) test is a method of estimation of total concentration of organic…
Q: (osgnthesis
A: Retrosynthesis is a breaking down of targeting molecule by the process of ''breaking down '' a…
Q: What term is typically used to describe gene systems that respond to the supply of a required…
A: These terms are generally used in operon models. An operon is a unit of bacterial gene expression…
Q: What is the difference between gain of function and loss of function mutations?
A: Mutations is a change in a DNA sequence that can be caused due to DNA replication error made during…
Q: . Adding as little as 0.1 mL of concentrated HCl to a liter of H20 shifts the pH from 7.0 to 3.0.…
A: Acetic acid and sodium acetate is an example of the acid - base buffer, in order to understand how…
Q: Explain in complete manner why these 3 became the major pathway that eventually become the entry…
A: Metabolism includes biosynthesis/ reduction (an anabolic process) and oxidation (catabolic…
Q: As you have seen, the protein assay relies upon the ability of proteins to bind the dye. Some…
A: Proteins are made up of amino acids attached together via peptide bonds. Proteins are composed of…
Q: Which patient/s may receive blood transfusion from an AB+ donor based on their blood typing profile?…
A: Given, Patient A is A positive Patient B is B positive AB+ blood can be donated only to AB+ blood…
Q: The structure below is a он NH но HO "он cerebroside monoglycosyl ceramide glycosphingolipid all are…
A: Lipids are a macro biomolecules made of fatty acid monomers, naturally occurring organic compounds…
Q: Five sweetener samples (labelled A to E) were tested by 97 individuals for the intensity of their…
A: Carbohydrates or carbs are maconutrient consisting of Carbon, hydrogen and oxygen atoms. In nature…
A transversion mutation would be replacing T by:
a. C
b. T
c. either A or G
d. U
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- A DNA nucleotide triplet that codes for the amino acid alanine is CCA b. CGG CCU d. CGU a. C.Which of the following rows identifies the mutated DNA sequence, complementary mRNA sequence, and resulting amino acid in a person with metabolic syndrome? Complementary mRNA Resulting Amino Acid Row A B D. OC. C D. D C Select one: OA A OB B Mutated DNA ATG ATG ACT ACT Metabolic syndrome is a genetic disorder with symptoms such as hypertension, elevated blood cholesterol, and low blood magnesium concentrations. This syndrome is caused by a mutation in which a cytosine nucleotide in the codon ACG is replaced by a thymine nucleotide. Use the following to answer the next AUG UAC ACU UGA Methionine Tyrosine Threonine StopWhat type of mutation is shown in the figure below? A. frameshift, insertion D. frameshift, deletion B. point mutation, silent C. base substitution, missense Normal hemoglobin DNA ст mRNA TT ALL Normal hemoglobin Glu Mutant hemoglobin DNA C I AT mRNA GU Sickle-cell hemoglobin Val
- Match the terms with the type of transposon B. v IS A. retrotranspson abundant in humans A. V L1 B. DNA transposon first discovered E V ACDS C. DNA transposon in bacteria F. V Alu D.ONA transposon C Tn E. Transposons in bacteria that can carry an antibiotic resistance gene. G. V RNA intermediate F retrotransposon D. V transpososome G.retrotransposon related with schzophreniaWhich of the following mutations is NOT a point mutation? A. Missense mutation B. Insertion mutation C. Nonsense mutation D. Silent mutationWhich of the following results in the same amino acid in its protein sequence? a. missense mutation b. sense mutation c. nonsense mutation d. antisense mutation
- Induced mutations A. are a random change in the DNA arising from errors in replications B. are a result of exposure to a mutagen C. always have a positive effect on the organism D. always have a negative effect on the organismA mutation caused by a base deamination or a tautomerization is called a a. silent mutation b. transition mutation c. nonsense mutation d. missense mutationA SNV mutation that results in no change in the amino acid sequence is called: A. silent mutation B. silencing mutation C. missense mutation D. nonsense mutation E. frameshift mutation
- which of these describes the symptoms of the disease(s) caused by mutations in this gene CAGATTGTGAAGAGGTCTCTTGA? Select all that apply a. Thread-like blood vessels in eyes b. Excessive bleeding c. Dwarfism d. UV light sensitivity e. sunburn f. BruisesThe first mutation is thought to occur in utero in most cases of ALL diagnosed before age 5 years Select one: A.Survival in children between age 2 and 10 years is now about 75% B.It is more frequent in males than females C.Peak age of onset is 2–4 years D.Females have a better prognosis than malesI. List the sequences of RNA that would be transcribed from the following DNA template sequences. a. TTACACTTGCTTGAGAGTC Ans: b. АСТTGGGCTАTGCTCATTA Ans: c. Ans: GGCTGCAATAGCССТAGAT d. GGAATACGTCTAGCTAGCA Ans: