66 Comparisons of DNA sequences among humans have revealed many types of variations. Which of the following variations involves duplication of relatively long stretches of DNA? Select one alternative: O Copy number variants Single nucleotide polymorphisms O Short tandem repeats O DNA ligation
Q: 5' UGUCAUGCUCGUCUUGAAUCUUGU GAUCCUCGUUGGAUUAAUUGU— 3' Translate the sequence of bases in the…
A: The amino acid chains are produced from the mRNA by the process of translation. In this translation…
Q: 2. The so-called hypervariable regions (HV1 and HV2)of the human mitochondrial genome are…
A: Mitochondrial DNA is a circular DNA present in the matrix of mitochondria. Mitochondria are thus…
Q: Questión 13 Which of the following DNA parts actually refers to a six -membered heterocyclic ring? A…
A: DNA and RNA are macromolecules that make up nucleic acid. DNA (Deoxyribonucleic acid) is a genetic…
Q: 13- Which of the following substitutions do not produce hidden mutations, that can not be observed…
A: The correct answer is (d)single substitution.
Q: Determine the characteristics of this piece of double-stranded DNA. GTCTTTTACTTGAAT…
A: DNA is the double helical structure that contains the information that help in inheritance. The…
Q: Give at least two differences between prokaryotic and eukaryotic DNAs
A: Prokaryotic cells do not possess membrane bound organelles and nucleus whereas, eukaryotic cell…
Q: 100 50 10 1 10 10 Cot DNA renaturation curves occasionally show three distinct phases of rena-…
A: The denatured DNA can reformulate hydrogen bonds between complementary single strand, making it…
Q: Fig 3.16 EcoRI SacI Kpnl ampR Aval Xmal Smal lacZ BamHI Xbal Sall AccI HincII PstI Sphl HindIII Bam…
A: A bacterial protein termed restriction enzyme, also known as molecular scissors, cleaves DNA at…
Q: 5-ccuaaucg-34 3'-acctgcctataccggattagetetgatectaagcatgte-5" The diagram above shows an RNA primer…
A: Given - RNA primer : B 5'-ccuaaucg-3" C Template strand : A…
Q: The human genome contains 3 billion nucleotides arranged in a vast array of sequences. What is the…
A: Genes are the hereditary unit of an organism. The DNA (deoxyribonucleic acid) forms the genes. DNA…
Q: The sequence of the 15 bp fragment from the previous problem is repeated below: 5' TCTGAATTCCGTAGA…
A: DNA is a double-stranded molecule that is made of several nitrogen base pairs. The nitrogen base of…
Q: 31.) The following DNA fragment was sequenced by the Sanger method. The asterisk indicates a…
A: ANSWER;-
Q: Given the choices, a. 25 b. 18 c. 23 d. 21 how many hydrogen bonds are present in a DNA double…
A: DNA is also known as deoxyribonucleic acid. DNA acts as genetic material in most of the organisms…
Q: 9. (2) Here is a sequence of double stranded DNA. Choose a pair of primers to amplify gene X.…
A: Polymerase Chain reaction or PCR is a rapid in vitro technique for amplifying target DNA…
Q: AKS 5c: In eukaryotic organisms like humans, DNA never leaves the nucleus. Which of the following is…
A: DNA contains all the information necessary for the regulation of cell metabolism in its nucleotides…
Q: There are various types of DNA-targeting drug, including DNA alkylating agents, DNA intercalators…
A: Mutations are DNA errors that occur during life. A mutation is defined as any alteration in the DNA…
Q: If R = any purine, Y = any pyrimidine, and N = any nucleotide, what is the probability of finding…
A: DNA stands for deoxyribonucleic acid. DNA is a polymeric molecule made up of nucleotides.…
Q: hy is the separation possible
A: DNA analysis is the term given to the clarification of genetic sequences and can be used for a vast…
Q: Z-DNA derives its name from the zig-zag conformation ofphosphate groups. What features of the DNA…
A: Z-DNA is one of the many possible double helical structures of DNA. It is a left handed double…
Q: The composition (mole fraction) of one of the strands of a double-helical DNA is (A] = 0.3, and (G]…
A: Given; [A]=0.3 and [G]=0.24 We have to follow Chargaffs rule here; A+T=G+C A forms 2 H bonds with T…
Q: 19. You have reasonably short, typical, double stranded DNA sequence. Basically how many proteins…
A: DNA's molecular structure is referred described as a "double helix." Two connected strands that…
Q: For the DNA segment 5′ TTGCAC 3′ how many of each of the following are present? nucleotides…
A: Nucleotides are the monomers of nucleic acids, DNA and RNA. A nucleotide is composed of a…
Q: A-DNA is a double-stranded form of DNA that has a helical radius and helical pitch compared to the…
A: Biological macromolecules are those large molecules that are necessary for the survival and growth…
Q: Why are consensus sequences found in cis-elements typically only 5-6 bases long? Question 19…
A: The consensus sequence is the calculated order of most frequent residues, either nucleotide or amino…
Q: The sequence of a region of interest in a DNA template strand is3′–ATACGACTAGTCGGGACCATATC–5′. If…
A: DNA sequencing is used to determine the exact arrangement of the nucleotide bases adenine (A),…
Q: 90. The DNA template fragment shown was sequenced by the Sanger method. A sample of the DNA was…
A:
Q: What type of chemical bonds hold together a DNA double helix? weak hydrogen bonds between…
A: DNA It is one of nucleic acid that constitutes two polynucleotide chains. These chains coil around…
Q: 1. The moon Titan orbits Saturn and is known to have a dense atmosphere and large pools of liquid…
A: DNA is a double stranded helical molecule that is made up of repeating nucleotides. The nucleotides…
Q: In Figure 1-8b, can you tell if the number of hydrogenbonds between adenine and thymine is the same…
A: DNA (Deoxyribonucleic acid ) the building blocks of DNA are the Nucleotides Nucleotides are made up…
Q: Which of the following feature/s characterize B-form DNA? I. Two antiparallel, polynucleoside chains…
A: The genetic material in most living organisms is present in the form of deoxyribonucleic acids…
Q: 3) Erwin Chargaff is considered one of the pioneering scientists in the field of molecular biology.…
A: According to the Chargaff’s Rule, DNA consists of nucleotides and contains nitrogen bases (Adenine,…
Q: How many hydrogen bonds are present in a DNA double helix fragment consisting of the following…
A: Deoxy ribonucleic acid is the double-stranded hereditary material that consists of sugar,…
Q: The human genome contains approximately 106 copies of an Alusequence, one of the best-studied…
A: Human genome contains approximately 106 copies of an Alu sequence best studied short interspersed…
Q: For entertainment on a Friday night, a genetics professor proposed that his children diagram a…
A: DNA Is a Polynucleotide. DNA is composed of nucleotides strung together to make a long chain called…
Q: 19. atways pairs with 20. always pairs with 21. An organism is found to have 30% Thymine bases. How…
A: Nitrogenous bases in DNA always pair up together. This was observed by Erwin Chargaff in the late…
Q: 5’-GATCAGCTGACTGGATCCGTCCTCAACGTCAGGATCCAGCTTCAAG-3’ 1. How many cuts do you expect this enzyme to…
A: Some enzymes are called endonucleases cleave the phosphodiester bonds that exist in the DNA. Some…
Q: Basisse triplet nommer/ Base triplet number 1 2 3 4 5 6 7 Menslike DNA-volgorde /…
A: The order of nucleotides in the nucleic acid is referred to as nucleic acid sequence. The process of…
Q: he enzymes BamH I and Bal II recognise different sequences but leave the same sticky ends: BamH…
A: An enzyme that recognizes a specific sequence on the DNA strand and cuts the DNA into fragments is…
Q: 52. Which of the following base pairings is CORRECT? Group of answer choices C-T A-C C-G A-G
A:
Q: Bating na region of noncoding DNA on chromosome 1. Would these differences be considered a mutation?…
A: Mutation is defined as the change in the nucleotide sequence. It does not matter if the change gets…
Q: Which two species in this DNA sequence alignment are the most closely related? Explain your answer…
A: DNA sequence alignment is the technique in which we study the similarity between two different…
Q: 18 Fred Sanger developed an effective DNA sequencing technique in 1977. Thepeed at which DNA can be…
A: Fred Sanger developed DNA sequencing technique in 1977. DNA sequencing is based on the base pairs…
Q: 34. Give the sequence of the complementary DNA strand of the DNA chain with the following base…
A: Complementarity refers to the lock-and-key relationship between two structures. Complementarity is a…
Q: T. aquaticusgenomic DNA is 34.3% guanosine nucleotides. What fraction of the DNA is adenosine…
A: Chromosome is a storehouse of genetic information. Each chromosome is made up of DNA (…
Q: The phenomenon where double-helical DNA absorbs UV light less than does single-stranded DNA is…
A: UV light absorbed by a double-stranded DNA is less UV light as compared to single-stranded DNA. It…
Q: DnaA proteins bind to repeated binding sites on the DNA double helix, helping to recruit the…
A: Replication is the process by which a double-stranded DNA molecule is copied to produce two…
Q: Describe the three-dimensional structure of DNA. 2. What is DNA denaturation?
A: a. DNA is a double-helical structure that carries the genetic information for the growth,…
Q: AKS 5c1: A researcher is examining the DNA sequences of a group of mice. He notices that in one of…
A: Silent mutation It is the change in the sequence of the nucleootide bases of the DNA. This change…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Although DNA transposons are abundant in the genomes of multicellular eukaryotes, class 1 elements usually make up the largest fraction of very large genomessuch as those from humans (~2500 Mb), maize (~2500Mb), and barley (~5000 Mb). Given what you knowabout class 1 and class 2 elements, what is it about theirdistinct mechanisms of transposition that would accountfor this consistent difference in abundance?Fig 3.16 EcoRI SacI KpnI |ampR Aval Xmal Smal lacZ BamHI Xbal SalI Accl HincII PstI Sphl HindIII Bam H1 Bam H1 Bam H1 1 2 3 4 The ends of the double-stranded DNA fragment above are blunt ends. The directionality of genes contained within the fragment is from left to right (arrow). After digestion by BamH1, which fragment can be inserted into the vector cut with BamH1 and Sma 1 maintaining the same directionality as the lacz promoter (green segment with arrow on vector)? 3 O 4 O1 2What is the basis for the lowfrequency of errors in DNA replicationobserved in all cells? Is this the bestthat cells can do given the speed ofreplication and the limits of moleculardiffusion? Was this mutation rateselected in evolution to provide geneticvariation?
- What Art the Features of the Series of -omes? Define the following terms: a. Genome b. Transcriptome c. Proteome d. Metabolome e. FluxomeIn addition to correcting DNA mismatches, themismatch repair system functions to prevent homologousrecombination from taking place between similar but notidentical sequences. Why would recombination betweensimilar, but nonidentical sequences pose a problem forhuman cells?Given the fact that 1 fg of DNA = 9.78 * 105base pairs (on average), you can convert the amount of DNA per cell to the lengthof DNA in numbers of base pairs. (a) Calculate the number of basepairs of DNA in the haploid yeast genome. Express your answer inmillions of base pairs (Mb), a standard unit for expressing genomesize. Show your work. (b) How many base pairs per minute weresynthesized during the S phase of these yeast cells?
- If you compare the frequency of the sixteen pos-sible dinucleotide sequences in the E. coli and humangenomes, there are no striking differences except for onedinucleotide, 5ʹ-CG-3ʹ. The frequency of CG dinucleotidesin the human genome is significantly lower than in E. coliand significantly lower than expected by chance. Why doyou suppose that CG dinucleotides are underrepresentedin the human genome?Give two different reasons for the much higher ratioof total DNA to protein-encoding DNA in the humangenome as compared to bacterial genomes.The best estimate is that the human genome containsfewer than 21,000 genes. However, there is evidencethat human cells produce many more than 21,000 different polypeptides. What processes might account for thisdiscrepancy?
- Researchers who study the molecular mechanism of transformationhave identified many proteins in bacteria that function in theuptake of DNA from the environment and its recombination intothe host cell’s chromosome. This means that bacteria have evolvedmolecular mechanisms for the purpose of transformation by extracellularDNA. What advantage(s) does a bacterium derive from importing DNA from the environment and/or incorporating it into its chromosome?On further analysis of the DNA described in conceptual questionC21, you discover that the triplex DNA in this alien organism iscomposed of a double helix with a third strand wound within themajor groove (just like the DNA in Figure shown). How would youpropose that this DNA is able to replicate itself? In your answer,be specific about the base-pairing rules within the double helixand which part of the triplex DNA would be replicated first.What is meant by the term semiconservativereplication? What are the functions of DNA Pol I and III,helicase, and primase? How does a leading strand differfrom a lagging strand?