3. The total number of cells in a human adult body (70 kg) is estimated to be 40 trillion. How many cells are there in a mouse (70 g) would you expect? A. 40 trillion, B. 40 million, C. 958 cells, D. 7 trillion
Q: In a particular population of mice, certain individuals display a phenotype called short tail, which…
A: Alleles are the alternative forms of a gene that are located on the same locus of a homologous…
Q: Point mutations in multiple tumor suppressor proteins have been linked to cancer. For example…
A: Note: Since you have posted a question with multiple sub-parts, we will solve the first three…
Q: Use the data to place the descriptions that best describe the carrying capacity in elk and bison…
A: Yellowstone's reintroduction of grey wolves was one of the most successful stories of the…
Q: 63. Which of the following labeled cells in the photomicrograph shown synthesizes antimüllerian…
A: Anti-mullerian hormone (AMH) AMH is essential for the development of a fetus's sex organs in the…
Q: Symptoms of deficiencies Drag and drop each symptom of deficiency to the correct type of substance.…
A: The deficiency of Vitamins, mineral, etc causes many types of disorder in our body which is related…
Q: Affinity and specificity of protein-protein interactions are mainly mediated by many weak chemical…
A: PPIs have been investigated using a variety of techniques and viewpoints, including biochemistry,…
Q: Diversification of species can be driven by factors such as physiological or morphological features…
A: The acquisition of new species through diversification and their removal through extinction…
Q: make a 5 referrence about fermentation in APA format
A: 1. Elmer L., Gaden Jr. (1959). Fermentation process kinetics. Journal of biochemical and…
Q: At the end of meiosis I: the cells are haploid and the homologous pairs are in separate cells.…
A: Meiosis is a two-stage process in which meiosis I can be referred to as the initial division.…
Q: In immunofluorescence experiments, what is the role of the primary and secondary antibodies? (select…
A: A standard laboratory method known immunofluorescence (IF) relies on the employment of certain…
Q: Transcribe the strand below: ACGGTACCGTTAGCCGACATCGGGGACACTGACTCG
A: The initial stage of gene expression, transcription, uses information from a gene to build a…
Q: Summary: In primary active transport, what provides the energy needed to move solutes against a…
A: Simple passive diffusion and facilitated diffusion are fundamental forms of membrane transport.…
Q: A researcher engineers a lac (lactose) operon on a plasmid but inactivates all parts of the lac…
A: Introduction Lac operon ,this concept was proposed by Jacob and monod in 1965. Operon is a…
Q: Joan was born with 6 toes on each foot, a dominant trait called polydactyly. Two of her 5 siblings…
A: Given: Joan was born with 6 toes on each foot, a dominant trait called polydactyly. Two of her 5…
Q: 1. Write the differences between the autonomic nervous system and the somatic one. Somatic nervous…
A: Introduction The somatic nervous system includes cranial nerves except optic nerve. The autonomic…
Q: How does this organism move?
A: When Monocystis is young, it is an intracellular parasite that lives in the bundle of developing…
Q: 15. Now, transcribe and translate the DNA strand below. Remember to use the start and stop…
A: Transcription and translation are terms used to describe two distinct biological processes: the…
Q: What are possible causes of the burning and what type of urine specimen should you obtain? asap
A: When urine is released from the bladder, it hurts, and this is known as urinary burning. Dysuria is…
Q: When exposed to a microbe, which antibody will be the first to respond? IgE IgM IgA IgG
A: Introduction:- Antibody are also known as immunoglobulins. Antibodies functions in recognition of…
Q: Which way is more common practice to characterize the strength of a binding reaction between a…
A: Answer : the more common practice to characterize the strength of a binding reaction between a…
Q: What is the other component of species diversity besides richness? Briefly describe how two…
A: Species diversity is the number of species that occupy the biosphere. The species diversity…
Q: How does epidemiologist fit in the field of Epidemiology?
A: The study and analysis of the distribution, patterns, and causes of health and illness conditions in…
Q: You performed a Genome-Wide Association Study (GWAS) attempting to link genotypes to the likelihood…
A: An odds ratio (OR) calculates the likelihood that an exposure will result in a particular result.…
Q: what is the most challenging behavior to control for maintaining a healthy body composition? Why?
A: Body composition can be defined as the relative ratio of muscles, bones, fat, water and other…
Q: Scientists carried out a microarray analysis to compare the gene expression of normal pancreatic…
A: Scientists can use microarray analysis to compare the gene expression of normal cells to that of…
Q: Humans have 46 chromosomes in each somatic cell. a. How many chromosomes does a child receive from…
A: Introduction:The nucleus has chromosomes, which house the genetic material. Autosomes and sex…
Q: to study a presumed inverse relationship between black tea consumption and cardiovascular disease,…
A: Given: Randomly selected sample=13,500 Age =50-64 Duration =January 2021 and September 2021 To…
Q: Label the following -phosphodiester bond -AT base pair -hydrogen bond -deoxyribose sugar -GC base…
A: DNA is a nucleic acid which also acts as genetic material. It is made up of deoxyribose, a pentose…
Q: Rarely, both sister chromatids of a replicated chromosome end up in one daughter cell. How might…
A: Mitosis is a cell division in which one mother cell will divides into two new daughter cells which…
Q: How might you change the warfarin dosing strategy for a patient that had a variant in CYP2C9 that…
A: CYP2C9 is a gene that encodes for an enzyme that is responsible for metabolizing certain drugs in…
Q: Identify the structure number seven on the flower below
A: Answer: A flower consists of several important parts to serve the different functions. The female…
Q: 12. The drawing below shows the respiratory system of a human: 111 E B K i) State the name of…
A: Introduction A network of tissues and organs called the respiratory system aids in breathing. Your…
Q: Enter title... What is horizontal gene transfer by conjugation between bacteria?
A: A process called horizontal gene transfer, often referred to as lateral gene transfer, occurs when…
Q: 53. Which of the following is a genetic disorder caused by a mutation in only a single nucleotide…
A: Sickle cell anemia - It is a genetic disorder that causes red blood cells to become sickle shaped…
Q: MORPHOLOGICAL CHARACTER LIST OF CALAMANSI (PHILIPPINE LIME). pls answer it completely. a. Leaf…
A: Morphological characteristics of Calamansi (Philippine Lime): Calamansi, also known as calamondin,…
Q: 5 Examples of adult cytogenetics test and applications
A: Cytogenetics is the branch of genetics deals with the study of chromosome abnormalities like…
Q: Name three difference between DNA and RNA. Include nucleotides and the sugar as two of your…
A: The genetic material controls the expression in an organism. There are two types of genetic material…
Q: Elaborately define the major considerations in dosage form design with example?
A: Drug substances are rarely administered alone; instead, they are combined with one or more…
Q: P is a dominant allele for pu following cross is performed flowers? In peas, T (tall) is dominant…
A: In a genetic cross, two different individuals are crossed or mated to produce off-springs that…
Q: hich type(s) of cell division (mitosis, meiosis I, meiosis II) reduce(s) the chromosome number by…
A: Introduction: Chromosomes are the DNA's compressed form. There are a set number of chromosomes in…
Q: Draw a diagram/flowchart and describe in detail the process of normal clot formation AND breakdown,…
A: The understanding of the blood coagulation system has advanced recently in anesthetic practice.…
Q: S1: ACGTCATCA S2: TAGTGTCA How many global alignments generate the same maximum score?
A: It is sequence alignment problem which solve for discovering for commonalities of genetics.
Q: Complete the cross and give the phenotype ratio of the offspring. DIHYBRID CROSS AaBb x AABb using…
A: Introduction : Genes serve as their basic units of inheritance in all living organisms. Alleles are…
Q: 16- A population's carrying capacity ____. a- increases as per capita growth rate (r) decreases…
A: The collection of all the individuals of same species in a particular area that interact with each…
Q: How is it possible for a bacterium to grow in a hypertonic environment?
A: A hypertonic environment is an environment where the external surrounding media have a higher…
Q: When a pathogen (or its toxins) enters the blood, the infection can spread throughout the body. Such…
A:
Q: A 45-year-old man complains of shooting pain down his right leg that worsens with sitting and…
A:
Q: Piebald spotting is a condition found in humans in which there are patches of skin that lack…
A: A person's physical and physiological features are all passed down to them through their genes,…
Q: Questions 1. suggest the specific agent for the disease
A: Ruminating animals or Ruminants are the animals which feed on plant-based food, since they possess a…
Q: Virchow's triad (the 3 essential elements) associated with venous thrombosis does not include:
A: deep vein thrombosis. As age increases, valves inside the lower legs weaken. These one-way valves…
3
Step by step
Solved in 2 steps
- 4) In DNA, adenine pairs up with thymine and guanine with cytosine. If adenine makes up 40% of the bases in DNA, then what percentage of the bases in DNA does cytosine makeup? A. 10% В. 20% С. 40% D. 50% 5I The process by vhich a cell conies its DNA befora it divides is called:About 1016 cell divisions take place in a human body during a lifetime, yet an adult human body consists of only about 1013 cells. Why are these two numbers so different?9. What is the unit of a genetic map? A. centimorgan B. angstrom C. joule D. centimeter
- 6. Consider an experiment in which cells are radioactively labeled by this method for only a short period of time (about 30 minutes). The radioactive thymidine medium is then replaced with medium containing unlabeled thymidine, and the cells are grown for some additional time. At different time points after replacement of the medium, cells are examined in a microscope. The fraction of cells in mitosis (which can be easily recognized because their chromosomes are condensed) that have radioactive DNA in their nuclei is then determined and plotted as a function of time after the labeling with radioactive thymidine. labeled mitotic cells (%) 100 75- 50 25 0 bod 0 5 10 15 20 25 30 time (hours) a) Would cells at all phases of the cell cycle contain radioactive DNA immediately after the labeling procedure? Why? b) Why are there initially no mitotic cells that contain radioactive DNA? c) Explain the rise and fall and then rise again of the curve. d) Estimate the length of G2 for these cells e)…19. The types of human cells shown below are different from one another, even though they all originated from the same fertilized egg and contain the same genetic information. Explain why these genetically identical cells can differ in structure and function. * Cardiac cells Stem cell Blastocyst Enterocytes Fat cells Neuron Red blood cells Epithelial cells Chondrocyte86. If you were to use the scientific method to determine if eating oat bran decreases people’s chance of getting cancer, which of the following studies would be best at answering the hypothesis. Assume it is possible to do each of the proposed studies. a. Survey 10,000 people who had cancer and 10,000 people who have not had cancer and see if one group ate more oat bran than the other. b. Select 10,000 people and ask them about how much oat bran they eat each week. Follow up on them over many years and see if the people who eat more oat bran are less likely to get cancer. c. Take a group of 500 people and randomly place 250 in each of two groups. Give one group two servings of oat bran every day for 20 years, and the other group two servings of some other food and see which group has more cancer cases in those 20 years. d. Find which ethnic groups eat the most oat bran and then compare cancer rates between those groups (since you would have a very large sample size).
- Cancer cells keep proliferation and eventually kills the host (human body). Unfortunately, you are diagnosed to have a small tumor (aggregation of cancer cells) of 1 mm in diameter (or 1 million cells). How big will the tumor g to 回国 be if it were untreated for two months (60 days)? Assume your cancer cells divide every 6 days. A. 10 million cells, B. 1 billion cells, C. 40 trillion cells. D. 1 million cells.9. Which of the following are the level of biological structure at which stem cells play a part? Select all that apply. A. macromolecular level B. cellular/ organelle levels C. tissue/ organ level D. organismal level E. all of the above none of the above15. Which of the following statements describes the lifespan of red blood cells?A. Red blood cells live as long as an animal and generally don't need to be replaced.B. Red blood cells live a few weeks in some species and a few months in others. Red blood cells live a few years in some species and as long as a few decades in others. D. Red blood cells live a few hours in some species and a few days in others.
- 3. An original cell replicates its DNA. The cell undergoes mitosis and cell division, and one of the daughter cells replicates its DNA. Which of these BEST describes the DNA of the second-generation daughter cells? A. One of the cells will contain DNA consisting of one strand from the original cell. B. One of the cells will contain DNA consisting of two strands from the original cell. C. Both of the cells will contain DNA consisting of one strand from the original cell. D. Both of the cells will contain DNA consisting of two strands from the original cell. E. Neither of the cells will contain DNA consisting of strands from the original cell.11. You study the cell cycle of human hepatocytes (i.e. cells from the main tissue of the liver). You isolate and culture a single hepatocyte from a tissue sample you have received. You then track the rate of cell division over time under the stimulation of a growth factor. After a few rounds of steady cell divisions, you notice that cells divide progressively faster, have a smaller volume and divide uncontrollably even in the absence of any growth factor. Which of the following is consistent with this observation? A. The G₂ checkpoint is functional but the G₁ checkpoint is non-functional B. The G₁ checkpoint is functional but the G₂ checkpoint is non-functional C. The Ras gene is mutated D. Cells undergo apoptosis E. Cells have entered the Go phase1. Which of the following describe the nuclear envelope? a. It is continuous with the endomembrane system b. It is continuous with the nucleolus c. It is continuous with the cell membrane d. It contains a cell membrane 2. During the cell cycle, when are chromosomes partitioned to daughter cells? a. G1 phase c. M phase b. G2 phase d. S phase 3. How do cancer cells differ from normal cells? a. invasiveness only – many normal cell types grow in an uncontrolled fashion b. interphase and M phase c. uncontrolled division and invasiveness d. uncontrolled division only – many normal cell types are invasive